Review



biotinylated common bean lectin  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Vector Laboratories biotinylated common bean lectin
    Biotinylated Common Bean Lectin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm40157085-124-52-57
    Average 94 stars, based on 28 article reviews
    biotinylated common bean lectin - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Kidney-targeted antioxidant salvianolic acid B nanoparticles restoring lysosome homeostasis for acute kidney injury therapy
    Article Snippet: Acute kidney injury (AKI) is highly correlated with oxidative stress, and the application of antioxidants is one of the promising treatments.. Salvianolic acid B (SAB) is a natural polyphenol with powerful antioxidant effects.. Due to its inherent characteristic of inferior bioavailability, its clinical application is impeded.

    Membrane:

    Article Title: SLC35A2-mediated bisected GlcNAc-modified extracellular vesicles enhance immune regulation in breast cancer lung metastasis.
    Article Snippet: This study investigates the role of SLC35A2-mediated bisected GlcNAc-modified small extracellular vesicles (sEVs) in breast cancer (BC) lung metastasis.. By modulating B3GALT1 expression, these sEVs regulate the premetastatic immune microenvironment, enhancing CD8+ T cell infiltration and reducing immune evasion.. The use of β-peptide-loaded sEVs further amplifies anti-metastatic effects, as demonstrated in vivo mouse models and molecular analyses.

    Incubation:

    Article Title: SLC35A2-mediated bisected GlcNAc-modified extracellular vesicles enhance immune regulation in breast cancer lung metastasis.
    Article Snippet: This study investigates the role of SLC35A2-mediated bisected GlcNAc-modified small extracellular vesicles (sEVs) in breast cancer (BC) lung metastasis.. By modulating B3GALT1 expression, these sEVs regulate the premetastatic immune microenvironment, enhancing CD8+ T cell infiltration and reducing immune evasion.. The use of β-peptide-loaded sEVs further amplifies anti-metastatic effects, as demonstrated in vivo mouse models and molecular analyses.

    Blocking Assay:

    Article Title: SLC35A2-mediated bisected GlcNAc-modified extracellular vesicles enhance immune regulation in breast cancer lung metastasis.
    Article Snippet: This study investigates the role of SLC35A2-mediated bisected GlcNAc-modified small extracellular vesicles (sEVs) in breast cancer (BC) lung metastasis.. By modulating B3GALT1 expression, these sEVs regulate the premetastatic immune microenvironment, enhancing CD8+ T cell infiltration and reducing immune evasion.. The use of β-peptide-loaded sEVs further amplifies anti-metastatic effects, as demonstrated in vivo mouse models and molecular analyses.

    Virus:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    Cell Isolation:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    Recombinant:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    Selection:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    Polymerase Chain Reaction:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    CRISPR:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    RNA Sequencing:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/

    Glycoproteomics:

    Article Title: Functional genomics identifies N-acetyllactosamine extension of complex N-glycans as a mechanism to evade lysis by natural killer cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-human CD107a FITC BD Biosciences 555800, clone H4A3; RRID: AB_396134 Anti-human CD56 BV421 BD Biosciences 562751, clone NCAM16.2; RRID: AB_2732054 Anti-human SPPL3 Millipore Sigma MABS1910, clone 7F9 Anti-human FBXO11 polyclonal NOVUS NB100-59826; RRID: AB_892469 Anti-human CD58 BD Biosciences 555919, clone 1C3; RRID: AB_396220 Anti-human CD58 PE BD Biosciences 555921, clone 1C3; RRID: AB_2076117 Anti-human MICB PE R&D Systems FAB1599P, clone 236511; RRID: AB_10972308 Anti-human MICB polyclonal R&D Systems AF1599; RRID: AB_354884 Anti-human TRAIL-R1 PE BD Biosciences 564180, clone S35-934; RRID: AB_2738648 Anti-human TRAIL-R2 PE BD Biosciences 565499, clone YM366; RRID: AB_2732871 Anti-human CD48 PE BD Biosciences 552855, clone TU145; RRID: AB_394496 Anti-human ICAM1 BD Biosciences 555511, clone HA58; RRID: AB_395901 Anti-human HLA-E BioLegend 342604, clone 3D12; RRID: AB_1659250 Anti-human MGAT5 R&D Systems MAB5469, clone 706824; RRID: AB_10972310 Anti-human actin Santa Cruz sc-8432, clone C-2; RRID: AB_626630 Anti-HA high affinity Millipore Sigma 11867423001, clone 3F10; RRID: AB_390918 Bacterial and virus strains Stellar E. coli HST08 competent cells TakaRa 636763 Endura E. coli Electrocompetent Cells Biosearch Technologies F861214 Biological samples Human Leukopak (for NK cell isolation) NIH blood bank NA Chemicals, peptides, and recombinant proteins Kifunensine Millipore Sigma K1140 Swainsonine Millipore Sigma S8195 Concanavalin A (Con A), FITC Vector labs FL-1001-25 Sambucus Nigra Lectin (SNA), FITC Vector labs FL-1301-2 Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC Vector labs FL-1121-2 Lycopersicon esculentum Lectin (LEL), FITC Vector labs FL-1171-1 Human CD2 Fc Chimera Protein R&D Systems 1856-CD Human NKG2D Fc Chimera Protein R&D Systems 1299-NK-050 Recombinant Human IgG1 Fc Protein R&D systems 110-HG-100 Critical commercial assays 123count eBeadsTM ThermoFisher 01-1234-42 Dead Cell Removal Kit Miltenyi Biotec 130-090-101 In-Fusion Snap Assembly Bundle TaKaRa 638945 EasySep Human NK Cell Enrichment Kit STEMCELL Technologies 19055 EasySepTM Human CD56 Positive Selection Kit STEMCELL Technologies 17855 PKH67 Green Fluorescent Cell Linker Kit SIGMA PKH67GL NEBNext High-Fidelity 2X PCR Master Mix New England Biolabs M0541L Deposited data Raw and analyzed CRISPR screen and RNA-seq data This paper GEO: GSE228188, Table S2 Glycoproteomics data This paper PRIDE: PXD040769, Tables S1 and S2 (Continued on next page) Cell Reports 43, 114105, April 23, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Source data This paper Table S3 Experimental models: Cell lines LCL 721.221 cell line Lab of Robert DeMars CelloSaurus, RRID: CVCL_6263 RIVA cell line Lab of Martin Dyer CelloSaurus, RRID: CVCL_1885 OCI-LY1 cell line Lab of Hans Messner CelloSaurus, RRID: CVCL_1879 WSU-NHL cell line DSMZ CelloSaurus, RRID: CVCL_1793 Lenti-X 293T TaKaRa 632180 Oligonucleotides sgSPPL3-1 (CTTGTTAAATACTGGCACAT) GeCKO V2 library Addgene library # 1000000049 sgSPPL3-2 (CGAGTAGGTCTGCTCCGCCA) GeCKO V2 library Addgene library # 1000000049 sgFBXO11 (ACTTCAACTACAGAAAACTT) GeCKO V2 library Addgene library # 1000000049 sgNT (TCCTGCCAAGAAACACCCTT) GeCKO V2 library Addgene library # 1000000049 sgMICB (CACCTGCAGCGAGGTCTCAG) GeCKO V2 library Addgene library # 1000000049 sgCD58 (CATGTTGTAATTACTGCTAA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10B (ACACATTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgTNFRSF10A (ACACACTCGATGTCACTCCA) GeCKO V2 library Addgene library # 1000000049 sgB2M (ACCGCGTGAGTAAACCTGAATCTT) GeCKO V2 library Addgene library # 1000000049 sgB3GNT2 (GTTCCTCTACTCCGGCCACC) GeCKO V2 library Addgene library # 1000000049 Recombinant DNA GeCKO V2 human CRISPR knockout library Sanjana et al.52 Addgene library # 1000000049 Human GlycoGene CRISPR pooled library Zhu et al.32 Addgene library #140961 LentiGuide-Puro vector Sanjana et al.52 Addgene plasmid #52963 Software and algorithms edgeR Robinson et al.53 https://bioconductor.org/packages/ release/bioc/html/edgeR.html MAGeCK Li et al.54 https://sourceforge.net/p/ mageck/wiki/Home/



    Similar Products

    biotinylated common bean lectin  (Vector Laboratories)
    94
    Vector Laboratories biotinylated common bean lectin
    Biotinylated Common Bean Lectin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm40157085-124-52-57
    Average 94 stars, based on 1 article reviews
    biotinylated common bean lectin - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fluorescein labeled phaseolus vulgaris erythroagglutinin (pha-e)  (Vector Laboratories)
    94
    Vector Laboratories fluorescein labeled phaseolus vulgaris erythroagglutinin (pha-e)
    Fluorescein Labeled Phaseolus Vulgaris Erythroagglutinin (Pha E), supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/custom%40fl-1121%4040769148
    Average 94 stars, based on 1 article reviews
    fluorescein labeled phaseolus vulgaris erythroagglutinin (pha-e) - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fitc e4 pha  (Vector Laboratories)
    94
    Vector Laboratories fitc e4 pha
    Fitc E4 Pha, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm38936637-48-81-82
    Average 94 stars, based on 1 article reviews
    fitc e4 pha - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fluorescein labeled phaseolus vulgaris erythroagglutinin pha e  (Vector Laboratories)
    94
    Vector Laboratories fluorescein labeled phaseolus vulgaris erythroagglutinin pha e
    Fluorescein Labeled Phaseolus Vulgaris Erythroagglutinin Pha E, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/10__1016_slash_j__cej__2024__151811-94-0-10
    Average 94 stars, based on 1 article reviews
    fluorescein labeled phaseolus vulgaris erythroagglutinin pha e - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fitc  (Vector Laboratories)
    94
    Vector Laboratories fitc
    KEY RESOURCES TABLE
    Fitc, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pmc11170631-27-4-6
    Average 94 stars, based on 1 article reviews
    fitc - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fitc vector labs fl 1121 2 lycopersicon esculentum lectin lel  (Vector Laboratories)
    94
    Vector Laboratories fitc vector labs fl 1121 2 lycopersicon esculentum lectin lel
    KEY RESOURCES TABLE
    Fitc Vector Labs Fl 1121 2 Lycopersicon Esculentum Lectin Lel, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm38619967-221-217-218
    Average 94 stars, based on 1 article reviews
    fitc vector labs fl 1121 2 lycopersicon esculentum lectin lel - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fluorescein labeled pha e  (Vector Laboratories)
    94
    Vector Laboratories fluorescein labeled pha e
    KEY RESOURCES TABLE
    Fluorescein Labeled Pha E, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm38565883-343-8-10
    Average 94 stars, based on 1 article reviews
    fluorescein labeled pha e - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pha e  (Vector Laboratories)
    94
    Vector Laboratories pha e
    KEY RESOURCES TABLE
    Pha E, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/FL-1121-2/Fluorescein+labeled+Phaseolus+Vulgaris+Erythroagglutinin+(PHA-E)/pm38565883-343-9-10
    Average 94 stars, based on 1 article reviews
    pha e - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Functional genomics identifies N -acetyllactosamine extension of complex N -glycans as a mechanism to evade lysis by natural killer cells

    doi: 10.1016/j.celrep.2024.114105

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Phaseolus Vulgaris Erythroagglutinin (PHA-E), FITC , Vector labs , FL-1121-2.

    Techniques: Virus, Cell Isolation, Recombinant, Plasmid Preparation, Selection, CRISPR, Knock-Out, Software